Fig. 1A)
Diagrammatic representation of sequenced portions of
the ML5 -ML6 region. Total size of the region inclusive of primers
is 416 bp in Suillus sinuspaulianus. Most other taxa have very similar-sized fragments. The first two shaded regions indicate size-variable portions of the fragment. The 5' most region, which contains the ML5 primer sequence, was excluded from the analysis because it varies as much as 100 bp in size and the sequences are too different to be aligned. The database starts immediately after this region with the conserved sequence indicated. Most taxa have a sequence that is nearly identical to the top line. The lower line shows the variant positions that are typical of members of the Russulaceae. The second shaded region contains small inserts of less than 15 bp in some agarics; it is included in the database, but portions of it are excluded from the analysis as described in the methods. The 3' most portion of the region is not determined for most taxa in the database, because of technical difficulties associated with its proximity to the ML6 primer. |
Fig.1B)
Five introns encountered infrequently in the taxa sampled.
Approximate locations of know introns is shown (vertical arrows,
a-e). Primers that work around these are indicated (horizontal
arrows) and their names and sequences are given. Flanking regions
of the gene that are outside of the target fragment are shown
with dashed lines. |
|
|
Primer | Sequence | Position relative to introns |
| ML5 | ctcggcaaattatcctcataag | interrupted by intron a | |
| ML6 | cagtagaagctgcatagggtc | 3' to intron e | |
|
|
MLIN3 | cgacacaggttcgtaggtag | 5' to target fragment |
|
|
ML5.5 | gatcctcatagttaagaccgc | 5' to intron b |
|
|
CML5.5 | tagcggtcttaactatgagg | 3' to intron a, 5' to others |
|
|
MLIN5R | ttattgataccggaccac | 3' to intron c, 5' to d |
|
|
MLIN4 | ggtagcaaaataaattggcc | 5' to intron c, 3' to b |
|
|
MLIN1R | agttgtagagacagtgaagc | 3' to intron d, 5' to e |
|
|
MLIN2 | ggccattaaatgtggtccgg | interrupped by intron c |
|
|
CML7.5 | ccgccccagtcaaactgcc | 3' to target fragment |
|
|
MLIN1F | gcttcactgtctctacaact | 5' to intron e, 3' to others |